Consument Study guides, Class notes & Summaries

Looking for the best study guides, study notes and summaries about Consument? On this page you'll find 390 study documents about Consument.

All 390 results

Sort by

Samenvatting: Consument en Marketing (MIDTERM 1) Samenvatting: Consument en Marketing (MIDTERM 1) Popular
  • Samenvatting: Consument en Marketing (MIDTERM 1)

  • Summary • 22 pages • 2024
  • Dit is een samenvatting voor de eerste midterm van Consument & Marketing, waarbij de hoofdstukken 1 t/m 6 worden behandeld van het boek: Consumer Behavior, 8e editie. De samenvatting is geschreven in het Engels
    (1)
  • $4.97
  • 5x sold
  • + learn more
Samenvatting MIDTERM 2 : Consument & Marketing Samenvatting MIDTERM 2 : Consument & Marketing
  • Samenvatting MIDTERM 2 : Consument & Marketing

  • Summary • 26 pages • 2024
  • Dit is een samenvatting voor de tweede midterm van het vak Consument & Marketing. Deze samenvatting bevat de hoofdstukken 7 t/m 14 van het boek Consumer Behavior (8e editie), die tot de tentamenstof behoren
    (0)
  • $4.97
  • 3x sold
  • + learn more
MNM2605 Consumer Behaviour - Assignment 4 - MW Motors Case Study
  • MNM2605 Consumer Behaviour - Assignment 4 - MW Motors Case Study

  • Essay • 12 pages • 2022
  • This assignment is about the case study of MW-Motors and how they have adapted their brand to satisfy their expanding consumer base. In this assignment we discuss the process Winnie will go through to make a decision about her purchase as well as establish the different trends that develops in consumer behaviour.
    (1)
  • $9.81
  • 2x sold
  • + learn more
Department of Life and Consumer Sciences Molecular Genetics
  • Department of Life and Consumer Sciences Molecular Genetics

  • Exam (elaborations) • 5 pages • 2022
  • Question 1 [15] Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ Question 2 [10] Your friend studying computer science is designing a new protein folding tool that will predict protein folding pathways. Explain to them, using your UNISA BCH3703 module content, why a particul...
    (1)
  • $11.99
  • 1x sold
  • + learn more
Consumer Behavior summary
  • Consumer Behavior summary

  • Summary • 71 pages • 2023 Popular
  • An all encompassing summary of the course Consumer Behaviour. Written in an organized, structured way with plenty of clear examples and visuals to guide you through the learning process. This summary includes; * all lectures * all guest lectures * the book Nudge by Thaler and Sunstein * all the required readings (articles, videos, ...) This course is given by Clara Cutello en Barbara Briers at the Faculty of Business and Economics.
    (0)
  • $12.20
  • 3x sold
  • + learn more
Summary Consumer Behaviour Marketing Management Erasmus University
  • Summary Consumer Behaviour Marketing Management Erasmus University

  • Summary • 53 pages • 2023
  • This is an extensive summary of the subject Consumer Behaviour at Rotterdam School of Management. It includes all notes from class and examples. I got an 8.5 with this summary.
    (0)
  • $7.21
  • + learn more
Samenvatting Consumer Behavior, ISBN: 9780357721292. Consument en Marketing (323623-B-6), Hoofdstuk 3. Samenvatting Consumer Behavior, ISBN: 9780357721292. Consument en Marketing (323623-B-6), Hoofdstuk 3.
  • Samenvatting Consumer Behavior, ISBN: 9780357721292. Consument en Marketing (323623-B-6), Hoofdstuk 3.

  • Summary • 8 pages • 2024
  • Samenvatting voor het vak Consument en Marketing (323623-B-6). Het bevat hoofdstuk 3 uit het boek Consumer Behavior 8th edition. Wayne D. Hoyer, Deborah J. MacInnis and Rik Pieters (2024). ISBN: 9780357721292.
    (0)
  • $5.43
  • + learn more
AAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% Accurate
  • AAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% Accurate

  • Exam (elaborations) • 10 pages • 2023
  • AAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccurateAAFCS 200* - Consumer & Resource Management Questions and Answers 100% AccuratePensions - ANSWER-are funds paid to retired employees who paid into a pension fund while they were employed. Social Security - ANSWER--A federal program under the direction of the S...
    (0)
  • $10.99
  • + learn more
AAFCS 200* - Consumer & Resource Management Exam with complete solutions
  • AAFCS 200* - Consumer & Resource Management Exam with complete solutions

  • Exam (elaborations) • 10 pages • 2023
  • AAFCS 200* - Consumer & Resource Management Exam with complete solutions
    (0)
  • $11.99
  • + learn more