Anti-ribosomal Study guides, Class notes & Summaries

GCD Exam 2 Practice Test Comp 86 Questions (chp 9-13) with Verified Answers Which of the following could be the components of a single nucleotide found in DNA? a. Ribose, phosphate, and cytosine b. Deoxyribose, phosphate, and uracil c. Deoxyribose, phosphate, and adenine d. Ribose, phosphate, and uracil - CORRECT ANSWER c. Deoxyribose, phosphate, and adenine 2. Which of the following is NOT a feature of the DNA double helix? a. It obeys the AG/TC rule. b. There are 10 nucleotides...

MB ASCP Demo Practice Exam Questions with complete solutions 1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' A. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D....

BTEC 6303 Exam 1 with 100% Verified Solutions What is the main difference between modern and classical biotechnology? - CORRECT ANSWER in modern biotechnology, DNA transfer is possible even between unrelated organisms Yeast is one example of a eukaryotic microbe that is extensively used in many industries. What is a characteristic of yeast but not bacteria? - CORRECT ANSWER 7'-methylguanosine cap is added to the 5' end of mRNA What is true of Gram negative bacteria? - CORRECT ANSWER...

NURSING MSN 571 - Quiz 2 Study Guide.| VERIFIED GUIDE Antibiotics Review terminology: 1. Selective Toxicity: The ability of a drug to injure a target cell or target organism without injuring other cells or organisms that are in intimate contact with the target. Refers to the ability of an antibiotic to injure only invading microbes and avoiding injuring the host. 2. Culture and Sensitivity test: Is a test done when trying to treat for infection. Culture is to determine the bacter...

PHARMACOLOGY NURSING What are the major functions of the α1 receptor? - Increase vascular smooth muscle contraction, increase pupillary dilator muscle contraction (mydriasis), increase intestinal and bladder sphincter muscle contraction What are the major functions of the α2 receptor? - Decrease sympathetic outflow, decrease insulin release, decrease lipolysis, increase platelet aggregation, decrease aqueous humor production What are the major functions of the β1 receptor? - Increase heart...

MB (ASCP) Exam Questions and Answers Graded A+ Predominant form of DNA Right-handed B DNA and histone interaction is due to what type of bond? Ionic What stains to the minor groove of DNA duplex? SYBR Green What is the most abundant type of RNA? Ribosomal RNA (rRNA) What does RNA act as in a retrovirus? Genome and mRNA What increases half-life of mRNA? 5' Methyl Cap What kind of DNA is most likely to be transcriptionally active? Euchromatin What is the most common type of eukaryot...

EXAMINATION TESTS OF MICROBIOLOGY VIROLOGY AND IMMUNOLOGY DISCIPLINE Basic bacteriology 1. Who first designed the microscope, saw and sketched microbes? A. Louis Pasteur B. Robert Koch C. Ilya Mechnikov D. Dmitri Ivanovsky E. Antonie Philips van Leeuwenhoek 2. Without which structures, bacteria cannot carry out their activities? A. Capsule B. Spors C. Volutine granules D. Nucleoid E. Flagella 3. What structure determines the shape of a bacterial cell? A. Cytoplasmic membrane B. ...

BIOS 1300 PreLab 3 Questions and Answers Rated A Centrosome Part of the cell that contains the centrioles and the centrosome matrix Function of the endocytic vesicle? Moves large particles, fluid, or molecules through plasma membrane and into cell What structure synthesizes protein for use inside the cell? Rough endoplasmic reticulum T/F: The nuclear envelope has a phospholipid bilayer True What structure regulates the passage of material between the cytoplasm and the nucleus? Cell membrane ...

MB (ASCP) Exam Questions and Answers Graded A+ Predominant form of DNA Right-handed B DNA and histone interaction is due to what type of bond? Ionic What stains to the minor groove of DNA duplex? SYBR Green What is the most abundant type of RNA? Ribosomal RNA (rRNA) What does RNA act as in a retrovirus? Genome and mRNA What increases half-life of mRNA? 5' Methyl Cap What kind of DNA is most likely to be transcriptionally active? Euchromatin What is the most common type of eukaryo...

UWorld NCLEX Cram EXAM 1 2023/2024 UWorld NCLEX Cram EXAM 1 2023/2024 Terms in this set (2000) Lambert Eaton Myasthenic Syndrome Lambert-Eaton Myasthenic Syndrome is a neuromuscular disorder presenting with proximal muscle weakness (trouble getting up the stairs or getting up), cranial nerve involvement, and autonomic symptoms (like impotence). many patients also have small cell lung cancer classically. Narcolepsy rare neurolgoic disorder characterized by episodes or ...